Ctrl + F on chrome opens up a search box that is used to find text on a web page, pdf, etc. It's one of the fastest ones I have seen and decided to dig deeper into what's going on.
So let's go on a journey of implementing a fast string matching algorithm.
Note: The algorithm which we will implement might be similar to the one used in Chrome, but since its Google we're talking about, they might've made optimizations
You might be wondering why do we need an algorithm when we have regular expression which does the same?
Yes we have regular expressions at our disposal but regular expressions are slow when we task it with finding patterns on large data, regular expression is awesome when we task it with finding a "dynamic patter" like all 10 digit phone numbers starting with +91, but in this case, we want to find one particular string.
If you want to know more Read here
This leaves us the only option of implementing a pattern matcher. Let's start with basic we can think about. We're given a document containing millions of words and we want to find one word, how shall we approach this? It's like finding a needle in a haystack.
Naive Approach
The first idea that we think of is comparing pattern and string character by character :
Implementation :
let string = "ATAATTACCAACATC";
let pattern = "ATC";
let position = [];
let found = true;
for(let i=0;i<string.length;i++){
found = true;
for(let j=0;j<pattern.length;j++){
if(string[i+j] != pattern[j]){
found = false;
break;
}
}
if(found){
position.push(i);
}
}
console.log(position);
But this performs in O(nm) time complexity, which is very slow.
How to optimize it?
For each string, if it doesn't match, we move by one character. How about skipping the whole word?
In this case, instead of starting all over again, we skip the string when it mismatches.
In the previous approach, we compared string nearly 45 times, here we compared string only 15 times which is a huge leap.
Here we can perform an optimization, instead of comparing from the front, how about comparing from the end?
In this case, we compared the string just 9 times, which is nearly half of the previous case.
But as you might've guessed this has a huge flaw of, what if the end characters match but starting character mismatch.
So we need a concrete algorithm that will skip characters such that overall character comparison decreases.
What other options do we have?
One thing which we could do is instead of moving the entire pattern, we move a part of the pattern.
We match each character between mismatched string and pattern, then we check if we have any common characters, if we do then we move only part of those characters.
In this case, we did 12 comparison operations and this will work if compare string and pattern from either side.
This algorithm is called the Boyer Moore Pattern Matching algorithm.
Implementation of Boyer Moore Pattern Matching algorithm
This is a modified version of the original algorithm, the original algorithm found only the first instance of the pattern, here we're finding all the occurrences of the pattern.
Step 1> create an empty map of size 256 (because 256 ASCII characters) and set to -1.
let string = "ATAATTACCAACATCATAATTACCAACATCATAATTACCAACATCATAATTACCAACATCATC";
let pattern = "ATC";
let M = pattern.length;
let N = string.length;
let skip; //to determine substring skip
let res = []; //to store result
let map = new Array(256); //array of 256 length
Step 2> Map character to its index in the pattern.
for(let c = 0;c<256;c++){
map[c] = -1; //initialize to -1
}
for(let j=0;j<M;j++){
map[pattern[j]] = j; //initialize to the it's index in pattern
}
Step 3> Loop over the string, notice that in the for loop, instead of "i++", we're using i+= skip, ie skip that part of the string.
for(let i=0;i<=N-M;i+=skip)
Step 4> Set skip to 0 during each iteration, this is important.
for(let i=0;i<=N-M;i+=skip){
skip=0;
}
Step 5> Match pattern with string.
for(let i=0;i<=N-M;i+=skip){
skip=0;
for(let j = M-1;j>=0;j--){
if(pattern[j] != string[i+j]){
skip = Math.max(1,j-map[string[i+j].charCodeAt(0)]);
break;
}
}
}
Step 6> If there's a mismatch, find the length that must be skipped, here we perform
skip = Math.max(1,j-map[string[i+j]]);
In some cases like eg : "ACC" and "ATC", in these cases the last character's match but rest do not.
Logically we must go back and match first "C" of the string with "C" of pattern, but doing so will mean that we are going back which we logically shouldn't or else we will be stuck in an infinite loop going back and forth.
To ensure that we keep on going forward with the matching process, we ensure that whenever we come across situations when there's a negative skip, we set skip to 1.
Step 7> If the skip is 0, ie there we no mismatch, add "i" to the result list.
if(skip == 0){
console.log(skip)
res.push(i);
skip++;
}
Combining them all :
let string = "ATAATTACCAACATCATAATTACCAACATCATAATTACCAACATCATAATTACCAACATCATC";
let pattern = "ATC";
let M = pattern.length;
let N = string.length;
let skip;
let res = [];
let map = new Array(256);
for(let c = 0;c<256;c++){
map[c] = -1;
}
for(let j=0;j<M;j++){
map[pattern[j]] = j;
}
for(let i=0;i<=N-M;i+=skip){
skip=0;
for(let j = M-1;j>=0;j--){
if(pattern[j] != string[i+j]){
skip = Math.max(1,j-map[string[i+j].charCodeAt(0)]));
break;
}
}
if(skip == 0){
res.push(i);
skip++;
}
}
console.log(res);
That's it! That's how Boyer Moore's pattern matching works.
There are many other Pattern Matching algorithms like Knuth Morris Pratt and Rabin Karp but these have their own use cases.
I found this on StackOverflow you can read it here but in a nutshell:
Boyer Moore : Takes O(m) space, O(mn) worst case ,best case Ω(m/n). preforms 25% better on dictionary words and long words. Pratcial usecase includes implementation of grep in GNU for string matching, chrome probably uses it for string search.
Knuth Morris Pratt: Takes O(m) space, O(m+n) worst case, works better on DNA sequences.
Rabin Karp: Use O(1) auxiliary space, this performs better under searching for long words in a document containing many long words (see StackOverflow link for more).
I hope you liked my explanation. I usually write about how to solve interview questions and real-life applications of algorithms.
If I messed up somewhere or explained something wrongly, please comment down below.
Thanks for reading! :)
github:https://github.com/AKHILP96/Data-Structures-and-Algorithms/blob/master/Algorithm/boyermoore.js
PS: I am looking for job, if you want someone who knows's how to design UI/UX while keeping development in mind, hit me up :) thanks!






Top comments (49)
Great write up on the different string matching algorithms!
The source code for the find in page is actually open source! You can see how it's implemented here: source.chromium.org/chromium/chrom...
Actual implementation: https://source.chromium.org/chromium/chromium/src/+/master:v8/src/strings/string-search.h;l=281;drc=e3355a4a33909a48ebb8614048d90cffc67d287e?q=string%20search&ss=chromium&originalUrl=https:%2F%2Fcs.chromium.org%2F
Looks like they swap in different algorithms based on the context.
OMG ! thanks for sharing :). I read on StackOverflow that somewhere around 2008-2010 when chrome was picking of, they shared how they've implemented a version of Boyer Moore's pattern matching algorithm. But I couldn't find it on youtube.
Very cool!
OMG !! Thanks for reading 🙏🙏🙏
🤓
That code does not work for a string which is consisting of only the same character. (e.g. pattern = 'TT')
so, after replacing 'skip = Math.max(1,j-map[string[i+j]]);' with 'skip = Math.max(1,j-map[string[i+j].charCodeAt(0)]);', working correctly.
Thanks for pointing out :) Code updated!
well, the combined code is still the same as before.
Good read
Thanks for reading :)
very interesting!
Thanks for reading :)
Yep, that's the beauty of the algorithm since we will store the last index, the "skip" will be large. Since the skip is large if the characters from the end do not match, we will skip even more characters bringing down the overall number of comparisons.
Hey Akhil! Amazing article! I had always wondered how is chrome able to find matching strings so fast.
One question, is this type of pattern matching slower or faster than using Regular Expressions (say in python)?
It depends on the complexity of the regex you're searching with. Regex engines usually build some sort of state machine from your regex, sort of like a compiler. Then they use that to check against the string. A state-machine based implementation will just be slower because of all of the extra variable changes it's having to do, but with simple enough regexes the compiled state machine might be fairly similar to this.
Regexes also aren't guaranteed to be much faster than a hand-written implementation for things like finding phone numbers, etc. They're pretty darn fast, don't get me wrong, but there might possibly be optimizations that could be made for specific use cases. Regex is just a convenient abstraction. Much like Javascript or Python, it's "just fast enough" for the vast majority of use cases, but for some like these, you need a better implementation for it to be performant.
I am not sure about its speed in python, maybe StackOverflow might help with that but overall regex are faster for dynamic situations like finding all phones numbers and algorithms might be faster for finding a particular phone number in a record of million phone numbers.
Regexes are generally functions, with arbitrary rules as to their composition. For example, "all 10 or 11 digit phone numbers starting with +91" might be expressed in regex as "
(?:\+91|\(\+91\))[ -]?\d{3}[ -]?\d{3}[ -]?\d{3}", but a compiled function might use many other tricks to find its way through the document, be it a trie (moderately memory intensive) or whatever.Regexes are just a simplified means of expressing functions, with their own grammatical structure.
Simple byte lookups (especially in an ASCII or ASCII compatible document) are dozens if not hundreds or thousands of times faster than composition of a function like that.
Yea, it depends on various factors like how many time regex is being executed etc.
Eg : If your string is 'QABC' and pattern is 'ABC' then the naive algorithm will perform better.
I read somewhere about the progress being made in fast string matching with regex using pattern matching algorithms with them.
That first one is true in js, but in most languages it's false.
Using regex to find string matches is still quite slow, but does work fairly well. In a compiled language, like rust, c, or go, it will be quite consistent, and have a constant time (unless gc interrupts it).
The short of it is: avoid regexes where possible. There are many premade solutions available.
Amazing post!!!!
I'll left here an implementation of BM and KMP I did in C for an university task just in case someone want to dig deeper on this.
github.com/Brugui7/Algorithmics/tr...
That's awesome! Thanks for reading :)
Boyer-Moore and KMP are both O(m+n) in the worst case. Please fix the typo (or check your references).
Worst case is still O(mn).
Read this : cs.cornell.edu/courses/cs312/2002s...
KMP is definitely O(m+n) even in worst case, because after the table construction (O(m)) it's just a linear scan on the string (O(n)).
Thanks for sharing! Updated!
Agreed, but your article shows O(mn).
This algorithm works well if the alphabet is reasonably big, but not too big. If the last character usually fails to match, the current shift s is increased by m each time around the loop. The total number of character comparisons is typically about n/m, which compares well with the roughly n comparisons that would be performed in the naive algorithm for similar problems. In fact, the longer the pattern string, the faster the search! However, the worst-case run time is still O(nm). The algorithm as presented doesn't work very well if the alphabet is small, because even if the strings are randomly generated, the last occurrence of any given character is near the end of the string. This can be improved by using another heuristic for increasing the shift. Consider this example:
T = ...LIVID_MEMOIRS...
P = EDITED_MEMOIRS
This is interesting. Thanks for sharing.
Thanks alot for reading :)